Phosphohistidine phosphatase
WebLOC127006239 14 kDa phosphohistidine phosphatase-like [ (Chinese mitten crab)] Gene ID: 127006239, updated on 4-Oct-2024. Summary Other designations. 14 kDa phosphohistidine phosphatase-like WebPhospholysine phosphohistidine inorganic pyrophosphate phosphatase - Wikipedia Phospholysine phosphohistidine inorganic pyrophosphate phosphatase Phospholysine …
Phosphohistidine phosphatase
Did you know?
WebGene ID: 126053682, updated on 16-Feb-2024. Summary Other designations. 14 kDa phosphohistidine phosphatase-like WebMar 1, 2002 · Such a phosphohistidine phosphatase, if present, should also serve as a modulator for the His-Asp phosphorelay. In this study, we intended to find such a hypothetical protein, and the E. coli SixA protein was identified as a candidate that interacts with the HPt domain of the ArcB anaerobic sensory kinase, through its dephosphorylation …
WebApr 1, 2016 · Phosphohistidine phosphatase 1 (PHPT1), the only known phosphohistidine phosphatase in mammals, regulates phosphohistidine levels of several proteins including … WebDec 4, 2024 · Phosphohistidine phosphatase 1 (PHPT1) also dephosphorylates phospholysine of chemically phosphorylated histone H1 and polylysine. Ups J Med Sci 2015; 120 :20–27. Article Google Scholar
WebJun 16, 2024 · Phosphohistidine (pHis) was discovered 60 years ago as a mitochondrial enzyme intermediate; since then, evidence for the existence of and phosphohistidine has emerged, together with examples where protein function is regulated by reversible histidine phosphorylation. pHis is chemically unstable and has thus been challenging to study. WebSixA was first reported to be a phosphohistidine phosphatase that dephosphorylates the histidine-containing phosphotransfer domain of the E. coli sensor kinase ArcB ( 32 , 41 ), and the activity was shown to be dependent on the conserved active-site histidine (His8) of SixA.
Although a clear consensus has not been reached, a large number of scientists adhere to a substrate-transport model to account for the catalytic properties of glucose 6-phosphatase. In this model, glucose 6-phosphatase has a low degree of selectivity. The transfer of the glucose 6-phosphate is carried out by a transporter protein (T1) and the endoplasmic reticulum (ER) contains structures allowing the exit of the phosphate group (T2) and glucose (T3).
WebApr 1, 2016 · Phosphohistidine phosphatase 1 (PHPT1), the only known phosphohistidine phosphatase in mammals, regulates phosphohistidine levels of several proteins including those involved in signaling,... cs lewis thankfulnessWebNov 10, 2024 · Although protein histidine phosphorylation was discovered in 1962 [], the enzymes responsible for dephosphorylation of phosphohistidine (pHis) in mammals were not discovered until much more recently [2,3,4,5,6,7,8].One of the major challenges in the field is the lability of pHis under relatively mild conditions [6,7,8], making the adduct much … c.s. lewis testimonyWebGene ID: 122554492, updated on 31-Aug-2024. Summary Other designations. 14 kDa phosphohistidine phosphatase eagle rising blue ridgeWebMar 10, 2024 · The 14-kDa phosphohistidine phosphatase (PHP14) protein, also called PHPT1, was the first histidine phosphatase identified in vertebrates (5, 6). In our previous … eagle ripping through flagWebNational Center for Biotechnology Information eagle rising food solutionsWebPhospholysine phosphohistidine inorganic pyrophosphate phosphatase: Lhpp: CCCTGGGAAAAGGACGCTATT AATCATGATGGCCTGGTGGG: Mechanistic target of rapamycin kinase: Mtor: CACCCATCCAACCTGATGCT ATCGAGACCGGTAACCTCCA: Regulatory associated protein of MTOR, complex 1: Rptor: TGGGTCTTCAACAAGGTAGC … eagle ring womenWebPhosphohistidine phosphatase 1 (PHPT1), also named protein histidine phosphatase (PHP), is a eukaryotic enzyme dephosphorylating proteins and peptides that are phosphorylated on a histidine residue. cs lewis that hideous strength pdf